austinhester468 austinhester468
  • 01-10-2017
  • Mathematics
contestada

Simplify the expressions. Show your work. (x + 6)^2

Respuesta :

Tinashashikant1 Tinashashikant1
  • 01-10-2017
the answer is x^2+12x+36
Answer Link

Otras preguntas

An increase in immigrants to Texas led to _________ education. A. extracurricular B. higher C. mandatory D. bilingual
Satellite can focus on specific latitudes using?
How many positive odd integers less than 300 can be formed using the digits 0, 1,2,3,4?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
The textbook defines _____ as a cluster of characteristics that are associated with all members of a specific social group, often including qualities that are u
The hydrosphere includes _____ 2.20 unit assessment: fundamentals of ecology, part 1
show work and factor ?
What are the points of discontinuity? Are they all removable? Please show your work.
Berlin laughs uncontrollably in where have you gone charming billy because he finds billys death
Find the missing length indicated