quille1893orx2c9 quille1893orx2c9

02-08-2017
English

contestada

The idea that love conquers all is an example of a

Respuesta :

garciamonserrat garciamonserrat

02-08-2017

It is an example of universal truth

Answer Link

morency24 morency24

12-05-2019

Answer:

universal truth is the right answer

Explanation:

Answer Link

Otras preguntas

Choose the correct order of organization from simplest to most complex. Organ > tissue > cell > organ system Organ system > organ > tissue > c

There are 756 students in the elementary school. The cafeteria holds 92 students. What is the least number of lunch period needed to serve all of the students?

The British army surrendered at Yorktown True or False?

y=2x+1 and y=5x+1 write the soultion set

What happens if some of your DNA is damaged by the environment?

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

What percent of 100 is 25? (this is a percent proportion question) (use: %/100 = is/of) *

How did the colonists react (what did they do) to The Intolerable Acts?

How do painting done in the style of Renaissance Naturalism depict objects

⚠️PLEASE HELP⚠️What is 439.048 as a mixed number