HopeJerger HopeJerger
  • 03-05-2015
  • Mathematics
contestada

is 4 m greater or less than 400 dm

Respuesta :

MyNameIsRobert MyNameIsRobert
  • 03-05-2015
1 meter equals 10 decimetres. So 400 dm equals 40 meters
Answer Link
mumsy
mumsy mumsy
  • 03-05-2015
NO, 400dm equals 40meters so 4m is less than 400dm
Answer Link

Otras preguntas

Which of the following did George Washington not warn Americans about in his Farewell Address? forming alliances with other countries forming trade relationship
A person flips a penny, a nickel, and a dime. Each coin can land with heads up (H) or tails up (T). The following tree diagram displays the different outcomes.
18. Given the following four lines, pick the true statement. Convert Line 1: 3v = 4x + 3 Line 2: 4y = 3x - 4 Line 3: 3x + 4y = 8 Line 4: 4x + 3y = -6 A. Lines 1
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
When do scientists believe matter formed
what is the area of the box
How many times can you step out the circle to throw the discus
What is the gram formula mass of K2CO3? 1. 138 g 2. 106 g 3. 99 g 4. 67 g
PLEASE HELP ME ASAPPPPPP!!!
I need the Blanks filled in with food from Spain and i need help Mesero: Aquí tienen el menú. Les recomiendo el menú del día que incluye su opción de _____,____