Walterperez10 Walterperez10

01-05-2017
History

contestada

Why did the U.S Navy never authorized the salvage of the USS Arizona

Respuesta :

RuralOregonDeputy RuralOregonDeputy

01-05-2017

Because the USS Arizona is considered a memorial site and grave for all of the sailors who lost their lives on Pearl Harbor. It is a place that people can visit as a museum and pay their respect for the ship's fallen crew.

Answer Link

Otras preguntas

Math homework need help with this one. Thank you

On the picture to the right, AB and AC are segments tangent to circle k(O). OB=3 cm, and OA =6 cm. Find AB, AC, m∠3, and m∠4.

Simplify the expression: (2x2 + 3x - 7) + (5x2 - x +9)

As passengers lined up to board an Acme Airliner, they are informed that there has been a bomb threat and that everyone must be searched. Ernesta is abnormally

what multiplies to 1.25 and adds up to 3

Use the graph below to answer the question. Select all of the zeroes of the function f(x)

9. Richard wants to start a college savings account forhis daughter. Which would be helpful advice to giveRichard in order to help him maximize his savingsamoun

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

what is formed when atoms join together with a covalent bond?

Given f (x) = 5x + 2 and g(x) = x – 3, find (fºg)(x)