EmmaliseL768960 EmmaliseL768960
  • 03-11-2022
  • Mathematics
contestada

-8, {0, -3, 1, -1}, {-1, 1, -2}, {3, -5, 4, -1}, {4, -2, 2}

8 0 3 1 1 1 1 2 3 5 4 1 4 2 2 class=

Respuesta :

RedietL14851 RedietL14851
  • 03-11-2022

Solution

17. -8

18. 0, -3 ,1 , -1

19. -1 ,1 ,-2

20. 3, -5 ,4 ,-1

21. 4, -2. 2

Ver imagen RedietL14851
Ver imagen RedietL14851
Ver imagen RedietL14851
Ver imagen RedietL14851
Ver imagen RedietL14851
Answer Link

Otras preguntas

There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
why is it critical to your cells to be near capillaries
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
The section of the small intestine between the duodenum and ilium?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5