oliverstanley0ovs207
oliverstanley0ovs207 oliverstanley0ovs207
  • 03-05-2022
  • Mathematics
contestada

Solve 7x-5=5x-4
Show Clear algebraic working

Respuesta :

armcgowan2006 armcgowan2006
  • 03-05-2022
Answer:

See below

Explanation:
Add 5 to -4
7x=5x+1
Subtract 5x to 7x
2x=1
Divide by two
x=1/2

Answer Link

Otras preguntas

I do need help._____.
Which phrase best describes nuclear fusion?(1 point) the process by which small nuclei combine into a larger nucleus a series of reactions in which particles fr
What is the length of DE? B E 15 18 X 12 49 А col CD 49 12 O A. 10 B. 6 C. 15 D. 9
An airplane accelerates down a runmway at 2.9 m/s/s for 38.5 seconds until if lifts off the ground. Determine the distance traveled on the runway before taking
Water is? A. the most abundant chemical in the body. B. a major component of the extracellular fluid. C. a component of the internal environment. D. a requireme
Find the slope of the table x y -2 3 -4 3 -6 3 -8 3
HELP what's your fav quote? mine is in the picture
plz help me I will mark as the brainlest I only need long answer plz help me ​
Which angle in ADEF has the largest measure? F 6 11 A. ZD O B. ZE C. ZF D. Cannot be determined
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'