malachijosiah15 malachijosiah15
  • 01-08-2021
  • Mathematics
contestada

How do u do this I don’t understand pls and thanks

How do u do this I dont understand pls and thanks class=

Respuesta :

171067292
171067292 171067292
  • 03-08-2021

Answer: Look it up on internet

Step-by-step explanation: INTERNET

Answer Link

Otras preguntas

what would happen to the nucleus if the mitochondria wasn't there
She said that she (already,see) .................Dr.rice
People who suffer from this eating disorder believe they are overweight and lose more weight than is considered healthy. bulimia nervosa binge-eating disorder
What impact do those in a career in sports turf management have on the agriculture industry and overall economy?
if f(x)= -x^2-3x+5, find f(-3)
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
ACTIVITY 3 Directions: After identifying the persuasive points, in your notebook, write a summary of the text.​
A race car driver pulls onto a circular track. After 10 seconds, his speed is 200 km/h. The car travels at a steady speed of 200 km/h for 100 seconds and then s
Escribe las frases abajo sustituindo las palabras subrayado por los correspondientes pronombres personales: A) Conseguí la información ayer. B) Di a tu amigo qu
1 3/8 + 3 2/8 = pls help me i have been on this for way to long