lilgoat2885 lilgoat2885
  • 01-07-2021
  • Mathematics
contestada

If f(x) = 3 - 4x, find f(1+a)
I am in the need of assistance thank you !

Respuesta :

Аноним Аноним
  • 01-07-2021

Step-by-step explanation:

f(x) = 3 - 4x

f(1+a)= 3-4(1+a)

=3-4+4a

=4a-1

Answer Link

Otras preguntas

The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
a antonym for biosphere
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
What is the noun in the sentence below? The fish swims quickly. a. Quickly b. Fish c. The d. Swims
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?
Help pl0x, Algebra 1
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
Who was the Queen of England when Shakespeare first became known as a great playwright? A. Elizabeth I B. Mary Tudor C. Victoria D. Anne Boleyn
Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?