seeenooooo1122 seeenooooo1122

03-06-2021
English

contestada

Write here——————————————————-

Write here class=

Respuesta :

03-06-2021

Answer:

I think the last sentence doesn't belong

Explanation:

i hope this helps!

Answer Link

Otras preguntas

Decide if you would use a conjugation of ser or estar for the underlined word. She is sick today. ("IS" the underlined word)A. serB. estar

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

is there estimates that her dinner has 48g of fat in it what percentage of her total daily allowance of fat does her meal contain her total daily allowance of f

did women in shakespeare england have the sane rughts as wimen in other parts of the world.

who was the finder of the mughal impire

Helllpppppppppppppkeiei

PLEASE HELP ME No one knows exactly when the first people came to the Guadalupe Mountains in far west Texas, but archaeological evidence dates back over 10,00

Answer the following questions.

Shrings dining room table is round and has a radius of 4.5 feet. What is the tabletops area? Plz

If 23.2 g of a given gas occupies a volume of 93.2 L at a particular temperature and pressure, what mass of the gas occupies a volume of 10.4 L under the same c