Cosmomontero16 Cosmomontero16

02-04-2021
Mathematics

contestada

please help me with this plzzzzzzzzzzzzzzz

the question is

Which table of values an exponential relationship

please help me with this plzzzzzzzzzzzzzzz the question is Which table of values an exponential relationship class=

Respuesta :

02-04-2021

Answer:

B

Step-by-step explanation:

The constant of proportionality is 5 in every column which makes it proportional.

Answer Link

Otras preguntas

Name and briefly describe 5 reflexes of a newborn. Will give Brainliest to first 2 people to answer!!! and whoever has the best answer!

What background knowledge would best add to a reader's understanding of a newspaper article about climate change?

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Divide 4x^4 - 24x^3 + 21x^2 -7x + 10 / x-5

i’m having trouble understanding this question.

What organelle is number 3

The cylinder below has a volume of 2,512 cubic cm and a height of 8 centimeters. What is the diameter of the cylinder? Use 3.14 for pi.

According to the monks stories, What common trait do Nebuchadnezzar and Belshazaar share

Simplify the expression. (7x + 3) + (4x - 1) - (2x + 4)

Which solution shown below contains an error?