robertguishardjr robertguishardjr
  • 01-03-2021
  • Mathematics
contestada

30.1593 rounded to the nearest hundredth NOW PLEASE

Respuesta :

ritadouaihy ritadouaihy
  • 01-03-2021

Answer:

30.16

Step-by-step explanation:

Answer Link

Otras preguntas

A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
what is 0.00001267 is scientific notation
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
the temperature of a sample of matter is a measure of the ?
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How do you put allele in a sentence
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea