Seudónimo Seudónimo
  • 02-11-2016
  • Mathematics
contestada

What is the word form for 13,406

Respuesta :

1mathwhiz 1mathwhiz
  • 02-11-2016
thirteen thousand four hundred and six
Answer Link

Otras preguntas

Occurs/Exists when the owner-manager makes all major decisions and monitors all activities while the staff serves as an extension of the managers supervisory a
Two boys on bicycles start cycling from the same place at the same time. one cyclist travels 15 miles per hour, the other travels 12 miles per hour, if they tra
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What name was given to the fight over slavery in the Kansas territory in the mid-1800’s?
One of the most damaging problems of the carter administration was its failure to win the release of u.s. hostages from
Identify the specific sensory receptors for each of the five common senses.
You have four coins 1 ¢ 5 ¢ 10 ¢ 25 ¢ How many different sums of money can you select? Use set notation to list all the options you have. How many options wi
how did white supremacists provide support for the ku klux klan
What is the First Language On world?
Adele earns about $15 each day in tips as a waitress. If she saves $7.50 of it, how many workings days will ot take her to save $225 ?