channelteddy
channelteddy channelteddy
  • 02-02-2021
  • Mathematics
contestada

Subject:Mathematics ​

SubjectMathematics class=

Respuesta :

THEHAPPYHEAD
THEHAPPYHEAD THEHAPPYHEAD
  • 02-02-2021

Answer:

its D

Step-by-step explanation:

Answer Link

Otras preguntas

What is the distance between points (-42, 63) and (-39, 67)?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What name was given to the fight over slavery in the Kansas territory in the mid-1800’s?
Find the product. (7x-2) (x+y)
Which one of the following will likely be revealed in the inspection report? A. school attendance zone B. termite damage C. age of the property D. liens
Help with these 4 questions please and thanks!!! 1. Find the radius of the circle x2 + 8x - 4 + y2 + 2y = 12 A. 9 B. 3 C. 5 D. 25 2. Find the center and radius
The culture of children strongly approves of children tattling on one and other. a. True b. False
What was the extent of islamic expansion one century after muhammad's death?
which department or agency conducts foreign policy and protects u s citizens in other countries?
Solve for x in terms of the other matrices and/or their inverses. x=b+ax