selfie101 selfie101
  • 02-12-2014
  • Mathematics
contestada

A8 x 3B = 2730
What number is A and B?      
You don't have to explain
Please answer soon

Respuesta :

Wenqian
Wenqian Wenqian
  • 02-12-2014
B=5  A=7  *If you need me to explain message me.
Answer Link

Otras preguntas

Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
Simplify. (-1/2)(4times)(-2)(7y)(-1) A. –28xy B. –28 C. 28xy D. 27
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
why did Mr Collins come to the Bennet family looking for a wife?
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
What is the additive inverse of -4a
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
the area of a rectangular garden is 38 1/4 square meters. the width of the garden is 4 1/2 meters. find the length of the garden
how would u form a superlative for the adverb widely