madisenraymond2287 madisenraymond2287
  • 03-01-2021
  • Geography
contestada

The Sahara is a hot desert yet people grow crops in some regions of this desert. What helps them to grow crops here?

Respuesta :

antiixs0ciial
antiixs0ciial antiixs0ciial
  • 03-01-2021

To survive they have made modified leaves into spines to prevent excessive loss of water from the plant body and deep roots to get to a water source.

Answer Link

Otras preguntas

The type and age of rocks found in the mountain range are also found on another continent. What might this mean?
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
What kind of problems did increased urbanization cause? During time of industrial revolution
why is it critical to your cells to be near capillaries
In terms of weather, what kind of boundary does the line labeled  X represent? A. occluded front B. stationary front C. cold front D. warm front
round 7,782 to the nearest hundred
is a centimeter one tenth or one hundredth or a meter
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5