dhambric4051 dhambric4051
  • 02-11-2020
  • Geography
contestada

increasing desertification and drought in Africa would have the GREATEST likelihood of

Respuesta :

bsnanamamsm bsnanamamsm
  • 02-11-2020
Increasing desertification and drought in Africa would have the GREATEST likelihood of resulting in starvation. As deserts expand in size, the available land for farming decreases. And if drought becomes more commonplace, even existing farmland will become unusable.
Answer Link

Otras preguntas

as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
Which body tissue or organ contains the most mitochondria?
A generator stores electric current. Explain why you agree or disagree with this statement
How many years does an apple tree live useful?
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Compliant is to stubborn as excited is to
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
Please help me with this two step math problem! THANK YOU !!!!!!!!